Review





Similar Products

rabbit anti p jak2 primary antibody  (Bioss)
94
Bioss rabbit anti p jak2 primary antibody
Effect of RRTS on <t>JAK2/STAT3</t> pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.
Rabbit Anti P Jak2 Primary Antibody, supplied by Bioss, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti p jak2 primary antibody/product/Bioss
Average 94 stars, based on 1 article reviews
rabbit anti p jak2 primary antibody - by Bioz Stars, 2026-02
94/100 stars
  Buy from Supplier
p jak 2  (Cell Signaling Technology Inc)
96
Cell Signaling Technology Inc p jak 2
Effect of RRTS on <t>JAK2/STAT3</t> pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.
P Jak 2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/p jak 2/product/Cell Signaling Technology Inc
Average 96 stars, based on 1 article reviews
p jak 2 - by Bioz Stars, 2026-02
96/100 stars
  Buy from Supplier
p jak2  (Cell Signaling Technology Inc)
98
Cell Signaling Technology Inc p jak2
Effect of RRTS on <t>JAK2/STAT3</t> pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.
P Jak2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/p jak2/product/Cell Signaling Technology Inc
Average 98 stars, based on 1 article reviews
p jak2 - by Bioz Stars, 2026-02
98/100 stars
  Buy from Supplier
primary antibodies against p jak2  (Cell Signaling Technology Inc)
96
Cell Signaling Technology Inc primary antibodies against p jak2
Effect of RRTS on <t>JAK2/STAT3</t> pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.
Primary Antibodies Against P Jak2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primary antibodies against p jak2/product/Cell Signaling Technology Inc
Average 96 stars, based on 1 article reviews
primary antibodies against p jak2 - by Bioz Stars, 2026-02
96/100 stars
  Buy from Supplier
anti p jak2 antibody  (Cell Signaling Technology Inc)
99
Cell Signaling Technology Inc anti p jak2 antibody
Effect of RRTS on <t>JAK2/STAT3</t> pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.
Anti P Jak2 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti p jak2 antibody/product/Cell Signaling Technology Inc
Average 99 stars, based on 1 article reviews
anti p jak2 antibody - by Bioz Stars, 2026-02
99/100 stars
  Buy from Supplier
p jak2 3776  (Cell Signaling Technology Inc)
98
Cell Signaling Technology Inc p jak2 3776
Effect of RRTS on <t>JAK2/STAT3</t> pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.
P Jak2 3776, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/p jak2 3776/product/Cell Signaling Technology Inc
Average 98 stars, based on 1 article reviews
p jak2 3776 - by Bioz Stars, 2026-02
98/100 stars
  Buy from Supplier

Image Search Results


Effect of RRTS on JAK2/STAT3 pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.

Journal: Frontiers in Pharmacology

Article Title: Mechanism of total saponins of Ranunculus ternatus Thunb. in treatment of breast cancer based on liquid chromatography–mass spectrometry and network analysis

doi: 10.3389/fphar.2025.1506885

Figure Lengend Snippet: Effect of RRTS on JAK2/STAT3 pathway. (A–C) Relative protein expression of p-JAK2, p-STAT3, JAK2, and STAT3. (D) mRNA expression of JAK2 and STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.

Article Snippet: The following supplies were used: Eleutheroside A standard (Chengdu Pusi Biotechnology; PS0811-0025); R. ternatus Thunb.plant medicine (Xinyang, Henan Province); a mouse IL-6 kit (Suzhou Calvin Biotechnology CK-E20012M); a mouse TNF-α kit (CK-E20220M); a mouse IL-10 kit (CK-E20206M); a human IL-6 kit (Suzhou Calvin Biotechnology Co., Ltd.; CK-E20665M); a human TNF-α kit (CK-E20036M); a human IL-10 kit (CK-E20667M); fetal bovine serum (Ausbian; S711-001S); RPMI-1640 basic medium with dual antibiotics (Wuhan Procell Life Science & Technology; PM150110A); rabbit anti-Bax primary antibody (Beijing Bioss; bs-0127R); rabbit anti-Bcl-2 primary antibody (Beijing Bioss; bs-4563R); rabbit GAPDH (GAPDH; Wuhan Sanying Biotechnology; GB-15004); rabbit anti-p-JAK2 primary antibody (Bioss; bs-3206R); Goat Anti-Rabbit IgG H&L antibody (Bioss; bs-40295G-IRDye800CW); primer sequence information 5′–3′ primer sequence: Mouse GAPDH (Forward: CCT​CGT​CCC​GTA​GAC​AAA​ATG, Reverse: TGA​GGT​CAA​TGA​AGG​GGT​CGT); Mouse JAK2 (Forward: GTG​CTT​TTG​AAG​ACA​GGG​ACC, Reverse: GGG​TCA​TAG​CGG​CAC​ATC​TC); MouseSTAT3(Forward:TGCGGAGAAGCATTGTGAGTG, Reverse: TCT​TAA​TTT​GTT​GGC​GGG​TCT); Human GAPDH (Forward: GGA​AGC​TTG​TCA​TCA​ATG​GAA​ATC, Reverse: TGA​TGA​CCC​TTT​TGG​CTC​CC); Human JAK2 (Forward: GGC​CTT​CTT​TCA​GAG​CCA​TCA, Reverse: TTT​TAC​AGC​GAC​CAC​CTC​CC); Human STAT3 (Forward: CTC​AAC​TAT​CTG​GAG​GAC​AAA​GGC, Reverse: TGA​CGC​CAC​TAA​ACA​CTT​CCC); Human Bax (Forward: CGG​GTT​GTC​GCC​CTT​TTC​TA, Reverse: GAG​GAA​GTC​CAA​TGT​CCA​GCC); Human Bcl-2 (Forward: GGA​GGA​TTG​TGG​CCT​TCT​TTG, Reverse: GCA​TCC​CAG​CCT​CCG​TTA​TC); microplate reader (BIO-RAD, United States; BIO-RAD680).

Techniques: Expressing, Control

Effect of RRTS on the growth of MCF-7 cell (A) Effect on proliferation of MCF-7 cells. (B, C) Effect on MCF-7 cell migration. (D) Effects on inflammatory cytokines IL-6,TNF-α and IL-10. (E) The apoptosis rate of the cells was detected by flow cytometry (Annexin V-FITC/PI method). (F) mRNA expression of JAK2 and STAT3. (G, H) Protein expression of proteins Bax, Bcl-2, JAK2, p-JAK2, STAT3 and p-STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.

Journal: Frontiers in Pharmacology

Article Title: Mechanism of total saponins of Ranunculus ternatus Thunb. in treatment of breast cancer based on liquid chromatography–mass spectrometry and network analysis

doi: 10.3389/fphar.2025.1506885

Figure Lengend Snippet: Effect of RRTS on the growth of MCF-7 cell (A) Effect on proliferation of MCF-7 cells. (B, C) Effect on MCF-7 cell migration. (D) Effects on inflammatory cytokines IL-6,TNF-α and IL-10. (E) The apoptosis rate of the cells was detected by flow cytometry (Annexin V-FITC/PI method). (F) mRNA expression of JAK2 and STAT3. (G, H) Protein expression of proteins Bax, Bcl-2, JAK2, p-JAK2, STAT3 and p-STAT3. Data were shown as the mean ± SD of three independent experiments. Compared with control group, * P < 0.05, ** P < 0.01.

Article Snippet: The following supplies were used: Eleutheroside A standard (Chengdu Pusi Biotechnology; PS0811-0025); R. ternatus Thunb.plant medicine (Xinyang, Henan Province); a mouse IL-6 kit (Suzhou Calvin Biotechnology CK-E20012M); a mouse TNF-α kit (CK-E20220M); a mouse IL-10 kit (CK-E20206M); a human IL-6 kit (Suzhou Calvin Biotechnology Co., Ltd.; CK-E20665M); a human TNF-α kit (CK-E20036M); a human IL-10 kit (CK-E20667M); fetal bovine serum (Ausbian; S711-001S); RPMI-1640 basic medium with dual antibiotics (Wuhan Procell Life Science & Technology; PM150110A); rabbit anti-Bax primary antibody (Beijing Bioss; bs-0127R); rabbit anti-Bcl-2 primary antibody (Beijing Bioss; bs-4563R); rabbit GAPDH (GAPDH; Wuhan Sanying Biotechnology; GB-15004); rabbit anti-p-JAK2 primary antibody (Bioss; bs-3206R); Goat Anti-Rabbit IgG H&L antibody (Bioss; bs-40295G-IRDye800CW); primer sequence information 5′–3′ primer sequence: Mouse GAPDH (Forward: CCT​CGT​CCC​GTA​GAC​AAA​ATG, Reverse: TGA​GGT​CAA​TGA​AGG​GGT​CGT); Mouse JAK2 (Forward: GTG​CTT​TTG​AAG​ACA​GGG​ACC, Reverse: GGG​TCA​TAG​CGG​CAC​ATC​TC); MouseSTAT3(Forward:TGCGGAGAAGCATTGTGAGTG, Reverse: TCT​TAA​TTT​GTT​GGC​GGG​TCT); Human GAPDH (Forward: GGA​AGC​TTG​TCA​TCA​ATG​GAA​ATC, Reverse: TGA​TGA​CCC​TTT​TGG​CTC​CC); Human JAK2 (Forward: GGC​CTT​CTT​TCA​GAG​CCA​TCA, Reverse: TTT​TAC​AGC​GAC​CAC​CTC​CC); Human STAT3 (Forward: CTC​AAC​TAT​CTG​GAG​GAC​AAA​GGC, Reverse: TGA​CGC​CAC​TAA​ACA​CTT​CCC); Human Bax (Forward: CGG​GTT​GTC​GCC​CTT​TTC​TA, Reverse: GAG​GAA​GTC​CAA​TGT​CCA​GCC); Human Bcl-2 (Forward: GGA​GGA​TTG​TGG​CCT​TCT​TTG, Reverse: GCA​TCC​CAG​CCT​CCG​TTA​TC); microplate reader (BIO-RAD, United States; BIO-RAD680).

Techniques: Migration, Flow Cytometry, Expressing, Control

JAK2/STAT3 pathway inhibition as potential mechanism of Ranunculus ternatus Thunb. For the treatment of breast cancer.

Journal: Frontiers in Pharmacology

Article Title: Mechanism of total saponins of Ranunculus ternatus Thunb. in treatment of breast cancer based on liquid chromatography–mass spectrometry and network analysis

doi: 10.3389/fphar.2025.1506885

Figure Lengend Snippet: JAK2/STAT3 pathway inhibition as potential mechanism of Ranunculus ternatus Thunb. For the treatment of breast cancer.

Article Snippet: The following supplies were used: Eleutheroside A standard (Chengdu Pusi Biotechnology; PS0811-0025); R. ternatus Thunb.plant medicine (Xinyang, Henan Province); a mouse IL-6 kit (Suzhou Calvin Biotechnology CK-E20012M); a mouse TNF-α kit (CK-E20220M); a mouse IL-10 kit (CK-E20206M); a human IL-6 kit (Suzhou Calvin Biotechnology Co., Ltd.; CK-E20665M); a human TNF-α kit (CK-E20036M); a human IL-10 kit (CK-E20667M); fetal bovine serum (Ausbian; S711-001S); RPMI-1640 basic medium with dual antibiotics (Wuhan Procell Life Science & Technology; PM150110A); rabbit anti-Bax primary antibody (Beijing Bioss; bs-0127R); rabbit anti-Bcl-2 primary antibody (Beijing Bioss; bs-4563R); rabbit GAPDH (GAPDH; Wuhan Sanying Biotechnology; GB-15004); rabbit anti-p-JAK2 primary antibody (Bioss; bs-3206R); Goat Anti-Rabbit IgG H&L antibody (Bioss; bs-40295G-IRDye800CW); primer sequence information 5′–3′ primer sequence: Mouse GAPDH (Forward: CCT​CGT​CCC​GTA​GAC​AAA​ATG, Reverse: TGA​GGT​CAA​TGA​AGG​GGT​CGT); Mouse JAK2 (Forward: GTG​CTT​TTG​AAG​ACA​GGG​ACC, Reverse: GGG​TCA​TAG​CGG​CAC​ATC​TC); MouseSTAT3(Forward:TGCGGAGAAGCATTGTGAGTG, Reverse: TCT​TAA​TTT​GTT​GGC​GGG​TCT); Human GAPDH (Forward: GGA​AGC​TTG​TCA​TCA​ATG​GAA​ATC, Reverse: TGA​TGA​CCC​TTT​TGG​CTC​CC); Human JAK2 (Forward: GGC​CTT​CTT​TCA​GAG​CCA​TCA, Reverse: TTT​TAC​AGC​GAC​CAC​CTC​CC); Human STAT3 (Forward: CTC​AAC​TAT​CTG​GAG​GAC​AAA​GGC, Reverse: TGA​CGC​CAC​TAA​ACA​CTT​CCC); Human Bax (Forward: CGG​GTT​GTC​GCC​CTT​TTC​TA, Reverse: GAG​GAA​GTC​CAA​TGT​CCA​GCC); Human Bcl-2 (Forward: GGA​GGA​TTG​TGG​CCT​TCT​TTG, Reverse: GCA​TCC​CAG​CCT​CCG​TTA​TC); microplate reader (BIO-RAD, United States; BIO-RAD680).

Techniques: Inhibition